Basic information for SNHG14-338-10aa-3
| Peptide Name | SNHG14-338-10aa-3 |
| Genome Position | chr15:25114831-25114860[+] |
| Species | Human |
| Peptide Sequence | MIHCAWQVCL |
| Peptide Length | 10 |
| Unique | No (SNHG14-270-10aa-6) |
| Grand Average of Hydropathicity | 1.36 |
| Relative Molecular Mass | 1365.64 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000671121;SNHG14-338 |
| Transcript Length | 8738 |
| Coding Ability | 0.4091 |
| DNA Sequence Corresponding to Peptide | ATGATCCACTGTGCCTGGCAAGTATGTTTG |
|
Conservation
|
|
|