Basic information for SNHG14-341-10aa
| Peptide Name | SNHG14-341-10aa |
| Genome Position | chr15:25078391-25078420[+] |
| Species | Human |
| Peptide Sequence | MLFWFPELHL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.97 |
| Relative Molecular Mass | 1494.74 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000224078;SNHG14 |
| Transcript ID/Name | ENST00000671491;SNHG14-341 |
| Transcript Length | 1869 |
| Coding Ability | 0.4794 |
| DNA Sequence Corresponding to Peptide | ATGCTTTTCTGGTTCCCTGAGCTGCACCTG |
|
Conservation
|
|
|