Basic information for SNHG17-207-10aa-2
| Peptide Name | SNHG17-207-10aa-2 |
| Genome Position | chr20:38428837-38428866[-] |
| Species | Human |
| Peptide Sequence | MESGWISFQL |
| Peptide Length | 10 |
| Unique | No (SNHG17-218-10aa-2,SNHG17-243-10aa,SNHG17-282-10aa) |
| Grand Average of Hydropathicity | 0.31 |
| Relative Molecular Mass | 1359.49 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000196756;SNHG17 |
| Transcript ID/Name | ENST00000449469;SNHG17-207 |
| Transcript Length | 2138 |
| Coding Ability | 0.6113 |
| DNA Sequence Corresponding to Peptide | ATGGAAAGTGGCTGGATTTCTTTCCAGTTG |
m6A
|
Conservation
|
|
|