Basic information for SNHG17-221-10aa
| Peptide Name | SNHG17-221-10aa |
| Genome Position | chr20:38422527-38422556[-] |
| Species | Human |
| Peptide Sequence | MPHFLFPFIC |
| Peptide Length | 10 |
| Unique | No (SNHG17-234-10aa,SNHG17-238-10aa,SNHG17-260-10aa,SNHG17-273-10aa,SNHG17-274-10aa-3) |
| Grand Average of Hydropathicity | 1.47 |
| Relative Molecular Mass | 1413.7 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000196756;SNHG17 |
| Transcript ID/Name | ENST00000655311;SNHG17-221 |
| Transcript Length | 1100 |
| Coding Ability | 0.4109 |
| DNA Sequence Corresponding to Peptide | ATGCCACATTTTCTTTTTCCATTCATCTGT |
|
Conservation
|
|
|