Basic information for SNHG17-227-10aa-1
| Peptide Name | SNHG17-227-10aa-1 |
| Genome Position | chr20:38426554-38426583[-] |
| Species | Human |
| Peptide Sequence | MAAAGVLYCP |
| Peptide Length | 10 |
| Unique | No (SNHG17-211-10aa,SNHG17-235-10aa-1) |
| Grand Average of Hydropathicity | 1.45 |
| Relative Molecular Mass | 1157.35 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000196756;SNHG17 |
| Transcript ID/Name | ENST00000657429;SNHG17-227 |
| Transcript Length | 1660 |
| Coding Ability | 0.3747 |
| DNA Sequence Corresponding to Peptide | ATGGCAGCTGCAGGAGTCTTGTACTGTCCC |
|
Conservation
|
|
|