Basic information for SNHG17-228-10aa-2
| Peptide Name | SNHG17-228-10aa-2 |
| Genome Position | chr20:38422092-38422118,38424201-38424203[-] |
| Species | Human |
| Peptide Sequence | MSHVLFLGLG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.55 |
| Relative Molecular Mass | 1235.45 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000196756;SNHG17 |
| Transcript ID/Name | ENST00000657665;SNHG17-228 |
| Transcript Length | 1154 |
| Coding Ability | 0.4818 |
| DNA Sequence Corresponding to Peptide | ATGAGTCATGTGCTGTTCCTGGGGCTTGGA |
m6A
|
Conservation
|
|
|