Basic information for SNHG17-243-10aa
| Peptide Name | SNHG17-243-10aa |
| Genome Position | chr20:38427876-38427905[-] |
| Species | Human |
| Peptide Sequence | MESGWISFQL |
| Peptide Length | 10 |
| Unique | No (SNHG17-207-10aa-2,SNHG17-218-10aa-2,SNHG17-282-10aa) |
| Grand Average of Hydropathicity | 0.31 |
| Relative Molecular Mass | 1359.49 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000196756;SNHG17 |
| Transcript ID/Name | ENST00000660064;SNHG17-243 |
| Transcript Length | 1444 |
| Coding Ability | 0.5976 |
| DNA Sequence Corresponding to Peptide | ATGGAAAGTGGCTGGATTTCTTTCCAGTTG |
|
Conservation
|
|
|