Basic information for SNHG17-256-10aa
| Peptide Name | SNHG17-256-10aa |
| Genome Position | chr20:38424030-38424059[-] |
| Species | Human |
| Peptide Sequence | MSVISHSHRF |
| Peptide Length | 10 |
| Unique | No (SNHG17-228-10aa-1,SNHG17-250-10aa) |
| Grand Average of Hydropathicity | 0.01 |
| Relative Molecular Mass | 1362.51 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000196756;SNHG17 |
| Transcript ID/Name | ENST00000663955;SNHG17-256 |
| Transcript Length | 1078 |
| Coding Ability | 0.4972 |
| DNA Sequence Corresponding to Peptide | ATGTCTGTTATCTCACATAGTCACCGTTTT |
|
Conservation
|
|
|