Basic information for SNHG17-273-10aa
| Peptide Name | SNHG17-273-10aa |
| Genome Position | chr20:38422332-38422361[-] |
| Species | Human |
| Peptide Sequence | MPHFLFPFIC |
| Peptide Length | 10 |
| Unique | No (SNHG17-221-10aa,SNHG17-234-10aa,SNHG17-238-10aa,SNHG17-260-10aa,SNHG17-274-10aa-3) |
| Grand Average of Hydropathicity | 1.47 |
| Relative Molecular Mass | 1413.7 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000196756;SNHG17 |
| Transcript ID/Name | ENST00000667188;SNHG17-273 |
| Transcript Length | 1316 |
| Coding Ability | 0.4065 |
| DNA Sequence Corresponding to Peptide | ATGCCACATTTTCTTTTTCCATTCATCTGT |
m6A
|
Conservation
|
|
|