Basic information for SNHG26-201-10aa
| Peptide Name | SNHG26-201-10aa |
| Genome Position | chr7:22859710-22859739[+] |
| Species | Human |
| Peptide Sequence | MISLKIGNLI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.44 |
| Relative Molecular Mass | 1263.53 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000228649;SNHG26 |
| Transcript ID/Name | ENST00000415611;SNHG26-201 |
| Transcript Length | 1938 |
| Coding Ability | 0.3395 |
| DNA Sequence Corresponding to Peptide | ATGATTTCATTGAAAATAGGAAATCTTATT |
|
Conservation
|
|
|