Basic information for SNHG26-213-10aa
| Peptide Name | SNHG26-213-10aa |
| Genome Position | chr7:22857117-22857146[+] |
| Species | Human |
| Peptide Sequence | MAPIIYRNII |
| Peptide Length | 10 |
| Unique | No (SNHG26-212-10aa) |
| Grand Average of Hydropathicity | 1.08 |
| Relative Molecular Mass | 1365.62 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000228649;SNHG26 |
| Transcript ID/Name | ENST00000671680;SNHG26-213 |
| Transcript Length | 619 |
| Coding Ability | 0.0485 |
| DNA Sequence Corresponding to Peptide | ATGGCCCCAATCATCTATAGGAATATTATT |
|
Conservation
|
|
|