Basic information for SNHG31-203-10aa-2
| Peptide Name | SNHG31-203-10aa-2 |
| Genome Position | chr2:214963219-214963248[+] |
| Species | Human |
| Peptide Sequence | MIRGIVPLTP |
| Peptide Length | 10 |
| Unique | No (SNHG31-202-10aa-2,SNHG31-204-10aa-2,SNHG31-205-10aa-1) |
| Grand Average of Hydropathicity | 1.01 |
| Relative Molecular Mass | 1258.56 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000229267;SNHG31 |
| Transcript ID/Name | ENST00000655899;SNHG31-203 |
| Transcript Length | 2104 |
| Coding Ability | 0.2714 |
| DNA Sequence Corresponding to Peptide | ATGATAAGGGGGATAGTACCGCTGACCCCA |
|
Conservation
|
|
|