Basic information for SNHG7-204-10aa-2
| Peptide Name | SNHG7-204-10aa-2 |
| Genome Position | chr9:136726729-136726758[-] |
| Species | Human |
| Peptide Sequence | MSAVPVSDSC |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.71 |
| Relative Molecular Mass | 1157.26 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000233016;SNHG7 |
| Transcript ID/Name | ENST00000447221;SNHG7-204 |
| Transcript Length | 2157 |
| Coding Ability | 0.3574 |
| DNA Sequence Corresponding to Peptide | ATGTCAGCAGTGCCAGTGTCAGACTCCTGC |
|
Conservation
|
|
|