Basic information for STX18-AS1-218-10aa
| Peptide Name | STX18-AS1-218-10aa |
| Genome Position | chr4:4787163-4787192[+] |
| Species | Human |
| Peptide Sequence | MVFCYSVQID |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.1 |
| Relative Molecular Mass | 1366.56 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000247708;STX18-AS1 |
| Transcript ID/Name | ENST00000670162;STX18-AS1-218 |
| Transcript Length | 2111 |
| Coding Ability | 0.4074 |
| DNA Sequence Corresponding to Peptide | ATGGTATTTTGTTATAGCGTCCAAATAGAC |
|
Conservation
|
|
|