Basic information for STX18-AS1-219-10aa-1
| Peptide Name | STX18-AS1-219-10aa-1 |
| Genome Position | chr4:4586524-4586553[+] |
| Species | Human |
| Peptide Sequence | MFAAVNFASE |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.93 |
| Relative Molecular Mass | 1248.35 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000247708;STX18-AS1 |
| Transcript ID/Name | ENST00000670249;STX18-AS1-219 |
| Transcript Length | 3086 |
| Coding Ability | 0.547 |
| DNA Sequence Corresponding to Peptide | ATGTTTGCAGCTGTGAATTTTGCCTCAGAA |
|
Conservation
|
|
|