Basic information for Snhg14-206-10aa-1
| Peptide Name | Snhg14-206-10aa-1 |
| Genome Position | chr7:59770453-59770482[-] |
| Species | Mouse |
| Peptide Sequence | MQCTPTSLDL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.12 |
| Relative Molecular Mass | 1270.5 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000100826;Snhg14 |
| Transcript ID/Name | ENSMUST00000187666;Snhg14-206 |
| Transcript Length | 2517 |
| Coding Ability | 0.3592 |
| DNA Sequence Corresponding to Peptide | ATGCAATGCACTCCAACGAGCTTGGATCTA |
|
Conservation
|
|
|