Basic information for Snhg14-211-10aa-1
| Peptide Name | Snhg14-211-10aa-1 |
| Genome Position | chr7:59974475-59974504[-] |
| Species | Mouse |
| Peptide Sequence | MYRVSQGIIL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.84 |
| Relative Molecular Mass | 1341.57 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000100826;Snhg14 |
| Transcript ID/Name | ENSMUST00000189581;Snhg14-211 |
| Transcript Length | 6861 |
| Coding Ability | 0.4066 |
| DNA Sequence Corresponding to Peptide | ATGTATAGAGTGTCACAGGGTATAATTTTG |
|
Conservation
|
|
|