Basic information for Snhg17-209-10aa-1
| Peptide Name | Snhg17-209-10aa-1 |
| Genome Position | chr2:158354321-158354350[-] |
| Species | Mouse |
| Peptide Sequence | MFPHAVSGGE |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.08 |
| Relative Molecular Mass | 1193.29 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000085385;Snhg17 |
| Transcript ID/Name | ENSMUST00000186993;Snhg17-209 |
| Transcript Length | 3144 |
| Coding Ability | 0.4348 |
| DNA Sequence Corresponding to Peptide | ATGTTCCCACATGCAGTGTCAGGAGGAGAG |
|
Conservation
|
|
|