Basic information for Sox1ot-202-10aa-1
| Peptide Name | Sox1ot-202-10aa-1 |
| Genome Position | chr8:12432961-12432990[+] |
| Species | Mouse |
| Peptide Sequence | MGKGKFAVSY |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0 |
| Relative Molecular Mass | 1249.44 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000047935;Sox1ot |
| Transcript ID/Name | ENSMUST00000186174;Sox1ot-202 |
| Transcript Length | 7420 |
| Coding Ability | 0.4813 |
| DNA Sequence Corresponding to Peptide | ATGGGCAAGGGAAAGTTTGCAGTTTCTTAC |
m6A
|
Conservation
|
|
|