Basic information for Sox2ot-202-10aa
| Peptide Name | Sox2ot-202-10aa |
| Genome Position | chr3:34611729-34611758[+] |
| Species | Mouse |
| Peptide Sequence | MVTTVAFSSK |
| Peptide Length | 10 |
| Unique | No (Sox2ot-205-10aa) |
| Grand Average of Hydropathicity | 0.8 |
| Relative Molecular Mass | 1232.48 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000105265;Sox2ot |
| Transcript ID/Name | ENSMUST00000196058;Sox2ot-202 |
| Transcript Length | 753 |
| Coding Ability | 0.5405 |
| DNA Sequence Corresponding to Peptide | ATGGTGACCACAGTAGCTTTCTCTTCAAAA |
m6A
|
Conservation
|
|
|