Basic information for Sox2ot-210-10aa-2
| Peptide Name | Sox2ot-210-10aa-2 |
| Genome Position | chr3:34677712-34677741[+] |
| Species | Mouse |
| Peptide Sequence | MPLVSALGRQ |
| Peptide Length | 10 |
| Unique | No (Sox2ot-206-10aa-2,Sox2ot-211-10aa-1) |
| Grand Average of Hydropathicity | 0.47 |
| Relative Molecular Mass | 1233.43 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000105265;Sox2ot |
| Transcript ID/Name | ENSMUST00000197697;Sox2ot-210 |
| Transcript Length | 2533 |
| Coding Ability | 0.3632 |
| DNA Sequence Corresponding to Peptide | ATGCCTTTAGTCTCAGCACTTGGGAGGCAG |
|
Conservation
|
|
|