Basic information for TMEM161B-AS1-222-10aa-1
| Peptide Name | TMEM161B-AS1-222-10aa-1 |
| Genome Position | chr5:88281893-88281922[+] |
| Species | Human |
| Peptide Sequence | MNGLVLSLWQ |
| Peptide Length | 10 |
| Unique | No (TMEM161B-AS1-251-10aa-1,TMEM161B-AS1-257-10aa-8) |
| Grand Average of Hydropathicity | 0.84 |
| Relative Molecular Mass | 1322.52 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000247828;TMEM161B-AS1 |
| Transcript ID/Name | ENST00000657491;TMEM161B-AS1-222 |
| Transcript Length | 1240 |
| Coding Ability | 0.55 |
| DNA Sequence Corresponding to Peptide | ATGAATGGCTTGGTGCTGTCTTTGTGGCAA |
|
Conservation
|
|
|