Basic information for TMEM161B-AS1-235-10aa-2
| Peptide Name | TMEM161B-AS1-235-10aa-2 |
| Genome Position | chr5:88321999-88322028[+] |
| Species | Human |
| Peptide Sequence | MCTFCFCLFF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.37 |
| Relative Molecular Mass | 1423.78 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000247828;TMEM161B-AS1 |
| Transcript ID/Name | ENST00000661627;TMEM161B-AS1-235 |
| Transcript Length | 2722 |
| Coding Ability | 0.2719 |
| DNA Sequence Corresponding to Peptide | ATGTGCACCTTTTGTTTTTGTTTGTTTTTT |
|
Conservation
|
|
|