Basic information for TMEM161B-AS1-257-10aa-10
| Peptide Name | TMEM161B-AS1-257-10aa-10 |
| Genome Position | chr5:88277937-88277966[+] |
| Species | Human |
| Peptide Sequence | MWINLESLLK |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.52 |
| Relative Molecular Mass | 1408.64 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000247828;TMEM161B-AS1 |
| Transcript ID/Name | ENST00000670451;TMEM161B-AS1-257 |
| Transcript Length | 15798 |
| Coding Ability | 0.3961 |
| DNA Sequence Corresponding to Peptide | ATGTGGATAAACCTTGAAAGCCTGCTGAAA |
|
Conservation
|
|
|