Basic information for TP53TG1-210-10aa-1
| Peptide Name | TP53TG1-210-10aa-1 |
| Genome Position | chr7:87323270-87323299[-] |
| Species | Human |
| Peptide Sequence | MVFNDLQVIF |
| Peptide Length | 10 |
| Unique | No (TP53TG1-202-10aa,TP53TG1-203-10aa) |
| Grand Average of Hydropathicity | 1.37 |
| Relative Molecular Mass | 1387.6 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000182165;TP53TG1 |
| Transcript ID/Name | ENST00000661943;TP53TG1-210 |
| Transcript Length | 3150 |
| Coding Ability | 0.361 |
| DNA Sequence Corresponding to Peptide | ATGGTGTTTAATGATCTTCAGGTTATATTT |
|
Conservation
|
|
|