Basic information for TRAM2-AS1-216-10aa-2
| Peptide Name | TRAM2-AS1-216-10aa-2 |
| Genome Position | chr6:52642275-52642304[+] |
| Species | Human |
| Peptide Sequence | MFNICFSLTK |
| Peptide Length | 10 |
| Unique | No (TRAM2-AS1-205-10aa-2,TRAM2-AS1-206-10aa-2) |
| Grand Average of Hydropathicity | 0.94 |
| Relative Molecular Mass | 1365.65 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000225791;TRAM2-AS1 |
| Transcript ID/Name | ENST00000667402;TRAM2-AS1-216 |
| Transcript Length | 4223 |
| Coding Ability | 0.4362 |
| DNA Sequence Corresponding to Peptide | ATGTTTAACATATGCTTCTCTTTGACCAAA |
|
Conservation
|
|
|