Basic information for TTTY10-202-10aa
| Peptide Name | TTTY10-202-10aa |
| Genome Position | chrY:20466635-20466664[-] |
| Species | Human |
| Peptide Sequence | MVGVLKKTLT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.83 |
| Relative Molecular Mass | 1251.62 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000229236;TTTY10 |
| Transcript ID/Name | ENST00000651837;TTTY10-202 |
| Transcript Length | 1668 |
| Coding Ability | 0.6013 |
| DNA Sequence Corresponding to Peptide | ATGGTGGGTGTCTTAAAAAAGACTCTAACT |
|
Conservation
|
|
|