Basic information for TTTY10-206-10aa-2
| Peptide Name | TTTY10-206-10aa-2 |
| Genome Position | chrY:20505179-20505208[-] |
| Species | Human |
| Peptide Sequence | MIYILWVYTQ |
| Peptide Length | 10 |
| Unique | No (TTTY10-212-10aa) |
| Grand Average of Hydropathicity | 1.12 |
| Relative Molecular Mass | 1491.78 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000229236;TTTY10 |
| Transcript ID/Name | ENST00000659275;TTTY10-206 |
| Transcript Length | 3567 |
| Coding Ability | 0.2899 |
| DNA Sequence Corresponding to Peptide | ATGATTTATATCCTTTGGGTATATACCCAG |
|
Conservation
|
|
|