Basic information for U91328.2-201-10aa
| Peptide Name | U91328.2-201-10aa |
| Genome Position | chr6:25983812-25983819,25999146-25999167[-] |
| Species | Human |
| Peptide Sequence | MEDKCVLLGG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.45 |
| Relative Molecular Mass | 1226.42 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000272558;U91328.2 |
| Transcript ID/Name | ENST00000608931;U91328.2-201 |
| Transcript Length | 354 |
| Coding Ability | 0.4746 |
| DNA Sequence Corresponding to Peptide | ATGGAAGACAAATGTGTACTGCTTGGCGGA |
m6A
|
Conservation
|
|
|