Basic information for UBR5-AS1-202-10aa-1
| Peptide Name | UBR5-AS1-202-10aa-1 |
| Genome Position | chr8:102252776-102252805[+] |
| Species | Human |
| Peptide Sequence | MWFSLLKEVI |
| Peptide Length | 10 |
| Unique | No (UBR5-AS1-201-10aa-2,UBR5-AS1-203-10aa-1) |
| Grand Average of Hydropathicity | 1.19 |
| Relative Molecular Mass | 1427.69 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000246263;UBR5-AS1 |
| Transcript ID/Name | ENST00000520820;UBR5-AS1-202 |
| Transcript Length | 2376 |
| Coding Ability | 0.1995 |
| DNA Sequence Corresponding to Peptide | ATGTGGTTCAGTCTTCTGAAGGAAGTTATA |
|
Conservation
|
|
|