Basic information for XIST-204-10aa-3
| Peptide Name | XIST-204-10aa-3 |
| Genome Position | chrX:73843870-73843899[-] |
| Species | Human |
| Peptide Sequence | MCWSFSLKLT |
| Peptide Length | 10 |
| Unique | No (XIST-225-10aa-2) |
| Grand Average of Hydropathicity | 0.77 |
| Relative Molecular Mass | 1377.65 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000229807;XIST |
| Transcript ID/Name | ENST00000429829;XIST-204 |
| Transcript Length | 19245 |
| Coding Ability | 0.3842 |
| DNA Sequence Corresponding to Peptide | ATGTGCTGGTCATTTTCTTTGAAATTGACT |
|
Conservation
|
|
|