Basic information for XIST-220-10aa
| Peptide Name | XIST-220-10aa |
| Genome Position | chrX:73829194-73829223[-] |
| Species | Human |
| Peptide Sequence | MPGTLALEDS |
| Peptide Length | 10 |
| Unique | No (XIST-203-10aa,XIST-204-10aa-5,XIST-205-10aa,XIST-206-10aa-1,XIST-207-10aa,XIST-209-10aa,XIST-211-10aa-1,XIST-212-10aa-2,XIST-213-10aa-3,XIST-214-10aa-2,XIST-215-10aa-2,XIST-216-10aa-1,XIST-217-10aa-1,XIST-218-10aa-1,XIST-219-10aa-4,XIST-221-10aa-2,XIST-222-10aa-1,XIST-223-10aa-3,XIST-224-10aa-1,XIST-225-10aa-4,XIST-226-10aa-2,XIST-227-10aa,XIST-228-10aa-2,XIST-230-10aa-2) |
| Grand Average of Hydropathicity | 0.08 |
| Relative Molecular Mass | 1195.32 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000229807;XIST |
| Transcript ID/Name | ENST00000649353;XIST-220 |
| Transcript Length | 2069 |
| Coding Ability | 0.5331 |
| DNA Sequence Corresponding to Peptide | ATGCCTGGCACTCTAGCACTTGAGGATAGC |
m6A
|
Conservation
|
|
|