Basic information for XIST-225-10aa-2
| Peptide Name | XIST-225-10aa-2 |
| Genome Position | chrX:73842739-73842768[-] |
| Species | Human |
| Peptide Sequence | MCWSFSLKLT |
| Peptide Length | 10 |
| Unique | No (XIST-204-10aa-3) |
| Grand Average of Hydropathicity | 0.77 |
| Relative Molecular Mass | 1377.65 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000229807;XIST |
| Transcript ID/Name | ENST00000650627;XIST-225 |
| Transcript Length | 13180 |
| Coding Ability | 0.4209 |
| DNA Sequence Corresponding to Peptide | ATGTGCTGGTCATTTTCTTTGAAATTGACT |
m6A
|
Conservation
|
|
|