Basic information for ZNF433-AS1-209-10aa-1
| Peptide Name | ZNF433-AS1-209-10aa-1 |
| Genome Position | chr19:12023741-12023770[+] |
| Species | Human |
| Peptide Sequence | MDNLGLFDQL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.17 |
| Relative Molecular Mass | 1327.45 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000219665;ZNF433-AS1 |
| Transcript ID/Name | ENST00000592187;ZNF433-AS1-209 |
| Transcript Length | 4000 |
| Coding Ability | 0.4762 |
| DNA Sequence Corresponding to Peptide | ATGGACAACCTGGGACTATTCGATCAATTG |
|
Conservation
|
|
|