Basic information for ZNF790-AS1-204-10aa-1
| Peptide Name | ZNF790-AS1-204-10aa-1 |
| Genome Position | chr19:36803193-36803222[+] |
| Species | Human |
| Peptide Sequence | MRLVTVPINR |
| Peptide Length | 10 |
| Unique | No (ZNF790-AS1-202-10aa,ZNF790-AS1-206-10aa-1) |
| Grand Average of Hydropathicity | 0.38 |
| Relative Molecular Mass | 1360.66 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000267254;ZNF790-AS1 |
| Transcript ID/Name | ENST00000589556;ZNF790-AS1-204 |
| Transcript Length | 2970 |
| Coding Ability | 0.2586 |
| DNA Sequence Corresponding to Peptide | ATGAGATTGGTTACCGTTCCGATAAATAGG |
|
Conservation
|
|
|