Basic information for ZNF790-AS1-207-10aa-2
| Peptide Name | ZNF790-AS1-207-10aa-2 |
| Genome Position | chr19:36829452-36829481[+] |
| Species | Human |
| Peptide Sequence | MNQYFIPCYA |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.23 |
| Relative Molecular Mass | 1411.6 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000267254;ZNF790-AS1 |
| Transcript ID/Name | ENST00000657461;ZNF790-AS1-207 |
| Transcript Length | 3024 |
| Coding Ability | 0.4279 |
| DNA Sequence Corresponding to Peptide | ATGAATCAGTACTTCATTCCTTGCTATGCC |
m6A
|
Conservation
|
|
|