Basic information for Zfp85os-201-10aa
| Peptide Name | Zfp85os-201-10aa |
| Genome Position | chr13:67754774-67754803[+] |
| Species | Mouse |
| Peptide Sequence | MGGLRKTHLL |
| Peptide Length | 10 |
| Unique | No (Zfp85os-202-10aa-1) |
| Grand Average of Hydropathicity | 0.02 |
| Relative Molecular Mass | 1287.57 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000044081;Zfp85os |
| Transcript ID/Name | ENSMUST00000049518;Zfp85os-201 |
| Transcript Length | 2624 |
| Coding Ability | 0.4817 |
| DNA Sequence Corresponding to Peptide | ATGGGAGGGCTCAGAAAAACCCACTTGCTC |
m6A
|
Conservation
|
|
|