Basic information for Zfp85os-202-10aa-4
| Peptide Name | Zfp85os-202-10aa-4 |
| Genome Position | chr13:67729351-67729380[+] |
| Species | Mouse |
| Peptide Sequence | MLACESSLSQ |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.44 |
| Relative Molecular Mass | 1230.35 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000044081;Zfp85os |
| Transcript ID/Name | ENSMUST00000143812;Zfp85os-202 |
| Transcript Length | 1784 |
| Coding Ability | 0.4731 |
| DNA Sequence Corresponding to Peptide | ATGTTAGCCTGTGAGTCGAGCCTTTCTCAG |
|
Conservation
|
|
|