Basic information for E430024I08Rik-202-10aa
| Peptide Name | E430024I08Rik-202-10aa |
| Genome Position | chr13:74463351-74463380[-] |
| Species | Mouse |
| Peptide Sequence | MLSPLPPLGG |
| Peptide Length | 10 |
| Unique | No (E430024I08Rik-207-10aa) |
| Grand Average of Hydropathicity | 0.69 |
| Relative Molecular Mass | 1143.34 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000112964;E430024I08Rik |
| Transcript ID/Name | ENSMUST00000220632;E430024I08Rik-202 |
| Transcript Length | 1513 |
| Coding Ability | 0.1646 |
| DNA Sequence Corresponding to Peptide | ATGCTGTCTCCACTCCCACCGCTCGGAGGA |
m6A
|
Conservation
|
|
|