Basic information for Xist-201-10aa-5
| Peptide Name | Xist-201-10aa-5 |
| Genome Position | chrX:103474513-103474542[-] |
| Species | Mouse |
| Peptide Sequence | MPLICVYCCC |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.15 |
| Relative Molecular Mass | 1309.66 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000086503;Xist |
| Transcript ID/Name | ENSMUST00000127786;Xist-201 |
| Transcript Length | 17946 |
| Coding Ability | 0.448 |
| DNA Sequence Corresponding to Peptide | ATGCCTCTTATTTGCGTGTACTGTTGCTGC |
m6A
|
Conservation
|
|
|